Review



pdcd10 reverse agccttgatgaaagcggctc realgene primer  (Proteintech)


Bioz Verified Symbol Proteintech is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Proteintech pdcd10 reverse agccttgatgaaagcggctc realgene primer
    Pdcd10 Reverse Agccttgatgaaagcggctc Realgene Primer, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdcd10 reverse agccttgatgaaagcggctc realgene primer/product/Proteintech
    Average 93 stars, based on 3 article reviews
    pdcd10 reverse agccttgatgaaagcggctc realgene primer - by Bioz Stars, 2026-02
    93/100 stars

    Images



    Similar Products

    ccl 86 oligonucleotides antibody variable sequence primers refs  (ATCC)
    99
    ATCC ccl 86 oligonucleotides antibody variable sequence primers refs
    Ccl 86 Oligonucleotides Antibody Variable Sequence Primers Refs, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ccl 86 oligonucleotides antibody variable sequence primers refs/product/ATCC
    Average 99 stars, based on 1 article reviews
    ccl 86 oligonucleotides antibody variable sequence primers refs - by Bioz Stars, 2026-02
    99/100 stars
    		  Buy from Supplier
    a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size  (Vector Laboratories)
    98
    Vector Laboratories a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size
    A11055 Ab 2534102 Nuclear Staining Dapi Na Vector Laboratories H 1200 Ab 2336790 Primers Target Size, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size/product/Vector Laboratories
    Average 98 stars, based on 1 article reviews
    a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size - by Bioz Stars, 2026-02
    98/100 stars
    		  Buy from Supplier
    detection primers pairs for m1  (Thermo Fisher)
    97
    Thermo Fisher detection primers pairs for m1
    Detection Primers Pairs For M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/detection primers pairs for m1/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    detection primers pairs for m1 - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    pdcd10 reverse agccttgatgaaagcggctc realgene primer  (Proteintech)
    93
    Proteintech pdcd10 reverse agccttgatgaaagcggctc realgene primer
    Pdcd10 Reverse Agccttgatgaaagcggctc Realgene Primer, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdcd10 reverse agccttgatgaaagcggctc realgene primer/product/Proteintech
    Average 93 stars, based on 1 article reviews
    pdcd10 reverse agccttgatgaaagcggctc realgene primer - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    alexa fluor 594 donkey anti rabbit igg proteintech sa00013 8 alexa fluor 488 donkey anti mouse igg proteintech sa00013 5 primer  (Proteintech)
    97
    Proteintech alexa fluor 594 donkey anti rabbit igg proteintech sa00013 8 alexa fluor 488 donkey anti mouse igg proteintech sa00013 5 primer
    Alexa Fluor 594 Donkey Anti Rabbit Igg Proteintech Sa00013 8 Alexa Fluor 488 Donkey Anti Mouse Igg Proteintech Sa00013 5 Primer, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alexa fluor 594 donkey anti rabbit igg proteintech sa00013 8 alexa fluor 488 donkey anti mouse igg proteintech sa00013 5 primer/product/Proteintech
    Average 97 stars, based on 1 article reviews
    alexa fluor 594 donkey anti rabbit igg proteintech sa00013 8 alexa fluor 488 donkey anti mouse igg proteintech sa00013 5 primer - by Bioz Stars, 2026-02
    97/100 stars
    		  Buy from Supplier
    primers for the myc antibody ip and negative control groups  (Sangon Biotech)
    90
    Sangon Biotech primers for the myc antibody ip and negative control groups
    Primers For The Myc Antibody Ip And Negative Control Groups, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers for the myc antibody ip and negative control groups/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    primers for the myc antibody ip and negative control groups - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    primer sequences  (Proteintech)
    93
    Proteintech primer sequences
    Primer Sequences, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer sequences/product/Proteintech
    Average 93 stars, based on 1 article reviews
    primer sequences - by Bioz Stars, 2026-02
    93/100 stars
    		  Buy from Supplier
    anti mef2a  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc anti mef2a
    Anti Mef2a, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti mef2a/product/Cell Signaling Technology Inc
    Average 94 stars, based on 1 article reviews
    anti mef2a - by Bioz Stars, 2026-02
    94/100 stars
    		  Buy from Supplier
    primers 434 anti p53  (Santa Cruz Biotechnology)
    96
    Santa Cruz Biotechnology primers 434 anti p53
    Primers 434 Anti P53, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers 434 anti p53/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    primers 434 anti p53 - by Bioz Stars, 2026-02
    96/100 stars
    		  Buy from Supplier

    Image Search Results